The Forgetting River: A Modern Tale of Survival, Identity, and the Inquisition
Author:Doreen Carvajal
Language: eng
Format: mobi
Tags: Non-Fiction, Religion, History
ISBN: 9781101596814
Publisher: Penguin
Published: 2012-08-16T00:00:00+00:00
Pruning the Tree
08
09
10
11
12
13
14
Arcos de la Frontera, 2008 15
16
The DNA kit was delivered in a small brown envelope with 17
three little swabs, liquid storage vials, and primitive how18
to line drawings with the look of illustrations from a 1950s 19
technical manual. The swabs were used to scrape the inner 20
lining of the cheek to collect cell samples for testing and they 21
were then packed in the vials for return to a Texas-based test22
ing company, Family Tree DNA. 23
It had not taken much urging to persuade my father to 24
take the test, though my first e-mail with my strange request 25
was initially ignored. But eventually my father agreed and 26
I ordered a DNA kit to be sent to him. I also scraped my S27
own samples, but it would give information only about my N28
01 maternal lines. I asked my father to join me because his DNA 02 sample would reveal his maternal and paternal lines, which 03 might offer clues to track distant relatives and lost branches 04 of the family tree.
05 The advantage of the testing is that it can tell you if two 06 individual men share a common male ancestor or whether 07 there are connections to others with similar-sounding sur08 names. The disadvantage is unexpected information: relatives 09 who don’t match, hidden adoptions, false paternities—bends 10 in the river of ancestors. The ultimate surprise is if there are 11 no matches—an ancestral black hole of nothingness. 12 “The DYS markers are short tandem repeats, sequences 13 of DNA that consist of repetitions of a short motif— 14 GATAGATAGATAGATAGATA—and so on. They are found 15 throughout the genome, and they vary from individual to 16 individual in the number of times they are repeated. That’s 17 what the numbers in the results are. They mutate quite fast: 18 they can add or subtract one unit once every five hundred 19 father-son transmissions,” Francesc Calafell, the Barcelona 20 geneticist, told me.
21 When my father’s results arrived from Family Tree—sent 22 by e-mail from California to Spain—I was baffled by mysteri23 ous codes within a series of twelve numbers. His initial test 24 revealed that his haplogroup is a G, which quick research 25 revealed originated in India or Pakistan dispersing to Central 26 Asia, Europe, and the Middle East. Its G2 branch was com27S monly found in Europe or the Middle East. When I checked 28N
Francesc’s study sample of Sephardic Jews I saw that it is dom01
inated by three haplogroups, J1, J2, and my father’s type, G. 02
Some families have used these genetic clues to resolve 03
family mysteries or confirm legends passed through genera04
tions. Descendants of Thomas Jefferson, the third president 05
of the United States, verified stories that they were most likely 06
descendants of Jefferson and his slave, Sally Hemings, ulti07
mately through DNA testing in 1998 and 2001 by comparing 08
Y chromosomes. The paternity, which couldn’t be established 09
with certainty, showed strong evidence that Jefferson fathered 10
her children. Further research showed that the Jefferson line 11
was K2—or now a T haplotype. It is rare in Europe, more 12
common in people of the Middle East and Africa.
Download
This site does not store any files on its server. We only index and link to content provided by other sites. Please contact the content providers to delete copyright contents if any and email us, we'll remove relevant links or contents immediately.
Still Foolin’ ’Em by Billy Crystal(36335)
We're Going to Need More Wine by Gabrielle Union(19020)
Plagued by Fire by Paul Hendrickson(17393)
Pimp by Iceberg Slim(14466)
Molly's Game by Molly Bloom(14124)
Becoming by Michelle Obama(10004)
When Breath Becomes Air by Paul Kalanithi(8408)
Educated by Tara Westover(8035)
The Girl Without a Voice by Casey Watson(7871)
The Incest Diary by Anonymous(7664)
Note to Self by Connor Franta(7657)
How to Be a Bawse: A Guide to Conquering Life by Lilly Singh(7458)
The Space Between by Michelle L. Teichman(6913)
What Does This Button Do? by Bruce Dickinson(6187)
Imperfect by Sanjay Manjrekar(5855)
Permanent Record by Edward Snowden(5814)
A Year in the Merde by Stephen Clarke(5397)
Shoe Dog by Phil Knight(5241)
Promise Me, Dad by Joe Biden(5132)